To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 41 | Bacillus anthracis spores (Ba) | Other | Bacillus anthracis spores | 80 | 1.5x10^12 CFU/mL | Reaction buffer: 350 uL 2 M Tris-HCl, 100 uL 1 M MgCl2, 7.7 mg dithiothreitol, and water | 53.75% | 5'-ACCCCTGCATCCTTTGCTGGAGAGGAATGTATAAGGATGTTCCGGGCGTGTGGGTAAGTCAGTCTAGAGGGCCCCAGAAT-3' | Fan, M. et al. "Aptamer selection express: A novel method for rapid single-step selection and sensing of aptamers." Journal of Biomolecular Technologies, 19 (2008): 311-321 |
| 42 | Mycoplasma bovis detection aptamer (WKB-14) | Protein | P48 of M. Bovis | 80 | 15.61 nM | Added to wells of plate coated with P48 protein solution (P48 protein dissolved in 100 uL of 0.05 carbonate-bicarbonate buffer) | 48.75% | 5-GCTGCAATACTCATGGACAGGTTGCGAAAGACAACGAATGCTTTGCCTGCCATAATTTGCGTCTGGAGTACGACCCTGAA-3 | Fu, P., et. al. Enzyme linked aptamer assay: based on a competition format for sensitive detection of antibodies to Mycoplasma bovis in serum. |
| 43 | Aflatoxin B1 Aptamer | Small Organic | Aflatoxin B1 | 80 | 11.39 nM | pH 7.0: 100 mmol/L NaCl, 20 mmol/L TrisHCl pH 7.6, 2 mmol/L MgCl2, 5 mmol/L KCl, 1 mmol/L CaCl2, 0.02 % Tween 20 | 55.00% | ||
| 44 | Aptamer ID 1 | Protein | PDGF-BB | 80 | 2.7 nM | 0.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, and 1 mM MgCl2 (PBSM), pH 7.4 | 52.50% | 5-TCCCACGCATTCTCCACATCATAAGCTGAGCATCTTAGATCCCCGTCAAGGGCAGCGTAA CCTTTCTGTCCTTCCGTCAC-3 | Cho et al. "Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing." PNAS 2010, 1-6/ |
| 45 | Aptamer ID 2 | Protein | PDGF-BB | 80 | 2.5 nM | 0.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, and 1 mM MgCl2 (PBSM), pH 7.4 | 52.50% | 5-TCCCACGCATTCTCCACATCGATACTGAGCATCGTACATGATCCCGCAACGGGCAGTATT CCTTTCTGTCCTTCCGTCAC-3 | Cho et al. "Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing." PNAS 2010, 1-6/ |
| 46 | Aptamer ID 3 | Protein | PDGF-BB | 80 | 2.6 nM | 0.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, and 1 mM MgCl2 (PBSM), pH 7.4 | 56.25% | 5-TCCCACGCATTCTCCACATCAGTTGAATGGTGTGGTCACTTCCAGTCCCGCAGGGCACACCCTTTCTGTCCTTCCGTCAC-3 | Cho et al. "Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing." PNAS 2010, 1-6/ |
| 47 | A1 | Protein | Staphylococcus aureus enterotoxin A (SEA) | 80 | 92.17 nM | 20 mM Tris, 100 mM NaCl, 5 mM KCl, 1 mM CaCl2 and 1 mM MgCl2 6H2O, pH 7.4 | 48.75% | 5-AGCAGCACAGAGGTCAGATGAGGCGATTACGCTTCTTGTACTTCAATAACGACTCAACTCCCTATGCGTGCTACCGTGAA-3 | Huang, Y. et al. "Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A." Anal. Methods, 2014, 6, 690-697. |
| 48 | A15 | Protein | Staphylococcus aureus enterotoxin A (SEA) | 80 | 48.57 nM | 20 mM Tris, 100 mM NaCl, 5 mM KCl, 1 mM CaCl2 and 1 mM MgCl2 6H2O, pH 7.4 | 47.50% | 5?-AGCAGCACAGAGGTCAGATGTACTTATGCATTTCCTCCCACGATCTTATTTGAGAGTGACCCTATGCGTGCTACCGTGAA-3? | Huang, Y. et al. "Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A." Anal. Methods, 2014, 6, 690-697. |
| 49 | A23.2 | Protein | Staphylococcus aureus enterotoxin A (SEA) | 80 | 235.00 nM | 20 mM Tris, 100 mM NaCl, 5 mM KCl, 1 mM CaCl2 and 1 mM MgCl2 6H2O, pH 7.4 | 38.75% | 5?-AGCAGCACAGAGGTCAGATGAAGGTCTTACATCAATTTATATATTTTTCCAATATCTGTCCCTATGCGTGCTACCGTGAA-3? | Huang, Y. et al. "Selection, identification and application of a DNA aptamer against Staphylococcus aureus enterotoxin A." Anal. Methods, 2014, 6, 690-697. |
| 50 | Leptin (Lep3) | Protein | Leptin | 81 | 0.32 ΅M | TGK 1X: 25 mM Tris, 192 mM glycine, and 5 mM potassium phosphate (pH 8.3) | 56.79% | 5'-CTTCTGCCCGCCTCCTTCCGTTAATGGGGGATCTCGCGGCCGTTCTTGTTGCTTATACAGGAGACGAGATAGGCGGACACT-3' | Ashley J and Li S FY. (2013) Three-dimensional selection of leptin aptamers using capillary electrophoresis and implications for clone validation. Anal Biochem. 434: 146-152 |