To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 301 | CL4 | nucleic acid | EGFR | 39 | 10 nM | phosphate-buffered saline (PBS) supplemented with 0.01% bovine serum albumin | 71.43 | 5?-GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3? | https://patents.google.com/patent/US9125930B2/en?oq=US+9125930 |
| 302 | EpCAM aptamer | transferrin receptor | 64 | 8.997±1.679 | PBS with 10% FCS, 1 mg/ml_ BSA, 0.1 mg/ml_ tRNA). Cells (50??_ | 51.56 | 5’-GAATTCCGCGTGTGCACACGCTCACAGTTAGTATCGCTACGTTCTTTGGTAGTCCGTTCG GGAT-3’ | https://patents.google.com/patent/WO2016127216A1/en?oq=WO+2016127216 | |
| 303 | Bifidobacterium breve | bifidobacterium breve | 80 | 11.47±0.99 | 50mmol / L Tris-HCl (pH 7.4), 5mmol / L KC1, lOOmmol / L NaCl, lmmol / L MgCl2 | 60 | 5'-AGCAGCACAGAGGTCAGATGCCGGGCAGCGGTCAATGCCGCAC CTTCCATATGATCGGGGCCTATGCGTGCTACCGTGAA-3' | https://patents.google.com/patent/CN105838719A/en?oq=CN+105838719 | |
| 304 | L-?serine aptamer | L-?serine | 45 | 33.24±7.73 | D-Hank's solution was added to 0.5mM MgC12 | 46.67 | 5'-ACGCATTTGTGTCGTTGGCGTATTGCCGTAAACGTACTAGCTGTA-3' | https://patents.google.com/patent/CN105821046A/en?oq=CN+105821046 | |
| 305 | glioma stem cells aptamers | glioma stem cell (GSC)? | 80 | 4.9±1.4 | 1xPBS, 4.5g/L glucose, 0.5mmol/LMgCl2, 0.1g/LtRNA, 1g/LBSA | 47.5 | 5'-TTGACTTGCCACTGACTACCCCAGTATCTCTTCAACGCTATGGTGCATGTACTACGTATTGAAGTCAGTCG GTCGTCATC-3' | https://patents.google.com/patent/CN105821043A/en?oq=CN+105821043 | |
| 306 | RA16 | non-small cell lung cancer | 100yL DEPC-H20, was added an equal volume of 0.2M NaHC03 solution, then add an appropriate amount of NHS-PEG (30kD) powder, rt for 2h, a final concentration of 20mM Tri s-HCl buffer and unreacted NHS, PEG-modified to give the RA16 | 68.18 | 5 '-GGGAGAGAACAAUGACCUGCGGUGCCAAGCCGUCGGGUUAUGUUGAUCUCCACAAGGACGAGUGC AUUGCAUCACGUCAGUAG-3' | https://patents.google.com/patent/CN105779458A/en?oq=CN+105779458 | |||
| 307 | STRG2 | Protein | MUC1-5TR-GalNAc; Tn antigen | 70 | 18.6 nM | 150 nM NaCl, 5nM MgCl2, pH 7.4 | 5'-dGpdApdGpdApdCpdApdApdGpdApdApdTpdApdApdApdCpdGpdCpdTpdCpdApdApdGpdGpdCpdTpdApdTpdApdGpdCpdApdCpdApdTpdGpdGpdGpdTpdApdApdApdApdCpdGpdApdCpdTpdTpdCpdGpdApdCpdApdGpdGpdApdGpdGpdCpdTpdCpdApdCpdApdApdCpdApdGpdGpdCp-3' | Ferreira, C.S.; Cheung, M.C.; Missailidis, S.; Bisland, S.; Gariepy, J. Phototoxic aptamers selectively enter and kill epithelial cancer cells. Nucleic acids research 2009, 37, 866-876. | |
| 308 | Mycolactone Aptamer | Protein | mycolactone | 0 | 6.3 µM | 1X concentration (1X PBS [pH 7.4] and 10 mMMgCl2) | Sakyi, Samuel A., et al. "RNA Aptamer That Specifically Binds to Mycolactone and Serves as a Diagnostic Tool for Diagnosis of Buruli Ulcer." | ||
| 309 | Epithelial cell adhesion molecule(EpCAM) | Protein | Cancer stem cell marker epithelial cell adhesion molecule | 19 | 12 nM | Assay Buffer: DPBS with 5 mM MgCl2, 0.1 mg/ml tRNA, 0.1 mg/ml salmon sperm DNA, 02% [w/v] sodium azide, and 5% FCS | 68.42% | S Shigdar et al. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule | |
| 310 | Interleukin-6 receptor | Cells | Cells presenting IL-6R | 19 | 8.5 nM | 137 mM NaCl, 2.7 mM KCl, 6.5 mM Na2HPO4, and 3 mM MgCl2 at PH 7.5. | 73.68% | 5' GGGGAGGCUGUGGUGAGGG 3' | Meyer C, U Hahn, et al. (2012) Interleukin-6 Receptor specific RNA aptamers for cargo delivery into target cells. RNA Biol |