To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 351 | Tetracycline (cb28 minimer) (ID# 116) | Small Organic | Tetracycline | 60 | ~1 µM | Equilibration Buffer: 10 mM TrisHCl (pH 7.6), 5 mM MgCl2, 250 mM NaCl | 50.00% | 5' GGCCUAAAACAUACCAGAUUUCGAUCUGGAGAGGUGAAGAAUUCGACCACCUAGGCCGGU 3' | Berens C, Thain, A, Schroeder R. (2001) A tetracycline-binding RNA aptamer. Bioorg Med Chem. 9:2549-2556. |
| 352 | Hepatitis B Virus (HBV) Polymerase (P protein) (A9) (ID# 253) | Protein | Hepatitis B Virus (HBV) Polymerase (P protein) | 61 | NA | binding buffer (0.1 M sodium phosphate (pH 7.4), 150 mM NaCl, 20 mM imidazol, 0.1% (v/v) NP-40, 100 mg/ml yeast tRNA), 30 °C | 36.07% | 5' UGGUUCAUGUCCUACUGUUCAAACAAAAAAACUGUGCACAAAAAUAAAUUGGGGCAUGGACA 3' | Feng et al. "A SELEX-Screened Aptamer of Human Hepatitis B Virus RNA Encapsidation Signal Suppresses Viral Replication." PLoS One, 6(2011): e27862 |
| 353 | ERK1/ ERK2 (Family II - Truncated) (ID# 481) | Protein | Extracellular Regulated Kinase 1 and 2 (ERK 1 and ERK2) | 63 | N/A nM | Buffer: 10 mM HEPES, pH 7.5; 10 mM MgCl2 | 42.86% | 5' GGAAAGACGCUAGCGAAUUGGUUCCUCGAAAGGGGAAAGCGUUAUUAAGAAACCAAAAUUUCC 3' | Seiwert, S., et al. "RNA aptamers as pathway-specific MAP kinase inhibitors." Chemistry & Biology, 7(2000): 833-834. |
| 354 | TLR3-ECD (Family-1) (ID# 211) | Protein | Toll-like receptor 3 Ectodomain | 64 | 2.1 nM | Binding buffer: 2 mM HEPES-NaOH (pH 7.6), 3 mM MgCl2, and 100 mM NaCl | 60.94% | 5' GGUAGAUACGAUGGAUACCCCCUGUGGCCCGUCAACACAGGGGAAGUGGCAUGACGCGCAGCCA 3' | Watanabe et al. "Isolation of RNA aptamers against human Toll-like receptor 3 ectodomain." Nucleic Acids Symposium Series No. 50 (2006): 251-252. |
| 355 | Estrogen Aptamer (AptER-1) (ID# 517) | Protein | Apo-estrogen receptor alpha | 65 | 16 nM | 12 mM HEPES/pH 7.6, 150 mM NaCl, and 10 mM MgCl2 | 58.46% | Xu, D., Chatakonda, V., Kourtidis, A., Conklin, D., and Shi, H. "In Search of Novel Drug Target Sites on Estrogen Receptors Using RNA Aptamers." Nucleic acid therapeutics 24.3 (2014): 227-38. | |
| 356 | Hepatitis C NS3 Protein (10G-1) (ID# 130) | Protein | Hepatitis C NS3 Protein | 66 | 990 pM | Binding Buffer: 50 mM Tris/HCl (pH 7.7), 30 mM NaCl, 5 mM CaCl2, 10 mM dithiothreitol and 1% BSA Elution Buffer (200 uL of 0.4 M sodium acetate, 5 mM EDTA, and 7 M urea (pH 5.5)) | 56.06% | 5' GGGAGAGCGGAAGCGUGCUGGGCCAGUAGUGUAUAGGGCUCGAAAUGUUCAUGGCUCAGUGGACAU 3' | Urvil, P., et al. "Selection of RNA aptamers that bind specifically to the NS3 protease of hepatitis C virus." European Journal of Biochemistry, 248(1997):130-138. |
| 357 | Dopamine (dopa2/c.4) (ID# 401) | Small Organic | Dopamine | 67 | 1.0 pM | Assay Buffer: 10 mM PBS, pH 7.2, 5mM MgCl2 | 62.69% | 5' GGGAAUUCCGCGUGUGCGCCGCGGAAGAGGGAAUAUAGAGGCAGCACAUAGUGAGGCCCUCCUCCC 3' | (A)Sequence from C Mannironi, et al. "In Vitro Selection of Dopamine RNA Ligands." Biochemistry, 36 (1997): 9726-973. (B) Enzyme-linked assay from H Park and I R Paeng. "Development of direct competitive enzyme-linked aptamer assay for determination of dopamine in serum." Analytica Chimica Acta, 685 (2011): 65-73. |
| 358 | Clone 488 (ID# 560) | Protein | SelB | 67 | NA | 50 mM potassium phosphate, pH 7.0, 5 mM Mg(OAc)2, 0.1 mM EDTA, 1 mM DTT, 0.5 mM GTP,0.02% Tween 20, 400 U/mL RNAsin | 67.16% | Klug, S. J. et al. "In vitro selection of RNA aptamers that bind special elongation factor SelB, a protein with multiple RNA-binding sites, reveals one major interaction domain at the carboxyl terminus." RNA, 1995 5: 1180 - 1190. | |
| 359 | Bovine Thrombin (T7 05 RNA) (ID# 55) | Protein | Bovine Thrombin | 68 | 164 nM | SHMCK+ buffer (20 mM Hepes (pH 7.35), 120 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2 and 0.1% geletin) containing 0.05% Tween 20. Binding Buffer (SHMCK+ buffer containing 0.05% Tween 20) | 44.12% | 5' GCAAUGGUACGGUACUUCCUUUGGAAGAUAGCUGGAGAACUAACCAAAAGUGCACGCUACUUUGCUAA 3' | (A) X Liu, et al. "RNA aptamers speci?c for bovine thrombin." Journal of Molecular Recognition, 16 (2003): 23-27. (B) X Liu, et al. "Screening of functional antidotes of RNA aptamers against bovine thrombin." FEBS Lett. 562(2004): 125-128 |
| 360 | 1G8-14 (ID# 580) | Protein | Ebola virus inhibitory domain (eVP35 IID) (EBOV) (eVP35) | 70 | 3.7 nM | 10mM HEPES (pH 7.0), 150mM NaCl, 2mM TCEP (tris(2-carboxyethyl)phosphine), 1mM MgCl2 | 60.00% | Jennifer M. Binning, Tianjiao Wang, Priya Luthra, Reed S. Shabman, Dominika M. Borek, Gai Liu, Wei Xu, Daisy W. Leung, Christopher F. Basler, and Gaya K. Amarasinghe, ??Development of RNA aptamers targeting ebolavirus VP35? Biochemistry 2013, 52, 8406-8419. |