To Upload your aptamers in our database
For LOGIN
# | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
---|---|---|---|---|---|---|---|---|---|
101 | Adenosine | Small Organic | ATP | 126 | 1 mM | Selection Buffer (300 mM NaCl, 50 mM Tris-acetate (pH 7.2)) | 48.41% | 5'-ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT-3' | Liu and Lu. "Adenosine-Dependent Assembly of Aptazyme-Functionalized Gold Nanoparticles and Its Application as a Colorimetric Biosensor." Analytical Chemistry, 76 (2004): 1627-1632. |
102 | ADCC Bi-specific Aptamer (bsA17) | Protein | CD16a positive cell lines | 132 | N/A nM� | Binding Buffer: DPBS with 0.05% BSA | 57.58% | 5'-CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGGGCAGGTCGCAGGTCGGAGGGAAAAGTTATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGATTAGTTTTGGAGTACTCGCTCC-3' | Boltz A, Plater B, Hock B, et al. (2011) Bi-specific Aptamers Mediating Tumour Cell Lysis. J Biol Chem. 286: 21896-21905. |
103 | Short Mitomer2 | Other | Mitochondria | 15 | 20mM Tris-HCl, 2mM KCl, 40mM NaCl, 1mM MgCl2, 250mM Sucrose, pH=7.5 | 80.00% | |||
104 | Epithelial cell adhesion molecule (EpCAM) (EpDT3) | Protein | Cancer stem cell marker epithelial cell adhesion molecule | 20 | 54.5 nM | Assay Buffer: DPBS with 5 mM MgCl2, 0.1 mg/ml tRNA, 0.1 mg/ml salmon sperm DNA, 02% [w/v] sodium azide, and 5% FCS. The final concentration of MgCl2�was 2.5 mM. | 68.42% | 5'-GCGACUGGUUACCCGGUCGT-3' | S Shigdar et al. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule. Cancer Sci 102(2011): 991-998 |
105 | Human Immunoglobulin G (IgG) (Apt 8) | Protein | hlgG-Fc | 23 | 75 nM | Binding Buffer (145mM NaCl, 5.4 mM KCl, 0.8mM MgCl, 1.8 mM CaCl, and 20 mM Tris-HCl (pH 7.6)) Modifications at the 5' and 3' end have been made by the authors for various testing. | 60.87% | 5'-GGAGGUGCUCCGAAAGGAACUCC-3' | Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. |
106 | Mitomer2 | Other | Mitochondria | 28 | 20mM Tris-HCl, 2mM KCl, 40mM NaCl, 1mM MgCl2, 250mM Sucrose, pH=7.5 | 71.43% | 5?-UCCCGAUUACUGUACAUACCUUAGCCCAUAGCUGGCUGC-3? | Yuri Tawaraya, Mamoru Hyodo, Mst Naznin Ara, Yuma Yamada, and Hideyoshi Harashima, RNA Aptamers for Targeting Mitochondria Using a Mitochondria-Based SELEX Method Biol. Pharm. Bull. 37(8) 1411-1415 (2014) | |
107 | Mitomer1 | Other | Mitochondria | 30 | 20mM Tris-HCl, 2mM KCl, 40mM NaCl, 1mM MgCl2, 250mM Sucrose, pH=7.5 | 70.00% | 5?-CACCACGAUCACGGUUUCCCUCGCAGGUAAGGUGUAGA-3? | Yuri Tawaraya, Mamoru Hyodo, Mst Naznin Ara, Yuma Yamada, and Hideyoshi Harashima, RNA Aptamers for Targeting Mitochondria Using a Mitochondria-Based SELEX Method Biol. Pharm. Bull. 37(8) 1411-1415 (2014) | |
108 | ErbB2 (SE15-8) | Protein | ErbB2 in Breast Cancer Cells | 34 | 3.49 nM | Binding buffer: 20 mM HEPES (pH 7.0), 150 mM NaCl, 1 mM MgCl2, 2 mM DTT, and 40 U RNase Inhibitor | 73.53% | 5'-AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU-3' | Kim and Jeong. "In Vitro Selection of RNA Aptamer and Specific Targeting of ErbB2 in Breast Cancer Cells." Oligonucleotides, doi:10.1089/oli.2011.028 |
109 | Interleukin 8 (8A-35) | Protein | Interleukin-8 (CXCL-8) | 35 | 1.72 pM | 30 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1.5 mM MgCl2, 2mM DTT, and 1% BSA | 40.00% | 5'-GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC-3' | Sung HJ, Choi S, Lee JW, Ok CY, Bae YS, Kim YH, Lee W, Heo K, Kim IH. Inhibition of human neutrophil activity by an RNA aptamer bound to interleukin-8. Biomaterials. 2014 Jan;35(1):578-89. doi: 10.1016/j.biomaterials.2013.09.107. Epub 2013 Oct 13. |
110 | C5a (C5C6) | Protein | Human complement C5 component (C5a) | 38 | 100 nM� | Binding Buffer: Phosphate-buffered saline with 1 mM MgCl2. | 55.26% | 5'-CGAUGCGGUCUCAUGCGUCGAGUGUGAGUUUACCUUCG-3' | G Biesecker et al.. "Derivation of RNA aptamer inhibitors of human complement C5." Immunopharmacology 42(1999):219-230 |