# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
101 Adenosine Small Organic ATP 126 1 mM Selection Buffer (300 mM NaCl, 50 mM Tris-acetate (pH 7.2)) 48.41% 5'-ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT-3' Liu and Lu. "Adenosine-Dependent Assembly of Aptazyme-Functionalized Gold Nanoparticles and Its Application as a Colorimetric Biosensor." Analytical Chemistry, 76 (2004): 1627-1632.
102 ADCC Bi-specific Aptamer (bsA17) Protein CD16a positive cell lines 132 N/A nM� Binding Buffer: DPBS with 0.05% BSA 57.58% 5'-CCACTGCGGGGGTCTATACGTGAGGAAGAAGTGGGCAGGTCGCAGGTCGGAGGGAAAAGTTATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGATTAGTTTTGGAGTACTCGCTCC-3' Boltz A, Plater B, Hock B, et al. (2011) Bi-specific Aptamers Mediating Tumour Cell Lysis. J Biol Chem. 286: 21896-21905.
103 Short Mitomer2 Other Mitochondria 15 20mM Tris-HCl, 2mM KCl, 40mM NaCl, 1mM MgCl2, 250mM Sucrose, pH=7.5 80.00%
104 Epithelial cell adhesion molecule (EpCAM) (EpDT3) Protein Cancer stem cell marker epithelial cell adhesion molecule 20 54.5 nM Assay Buffer: DPBS with 5 mM MgCl2, 0.1 mg/ml tRNA, 0.1 mg/ml salmon sperm DNA, 02% [w/v] sodium azide, and 5% FCS. The final concentration of MgCl2�was 2.5 mM. 68.42% 5'-GCGACUGGUUACCCGGUCGT-3' S Shigdar et al. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule. Cancer Sci 102(2011): 991-998
105 Human Immunoglobulin G (IgG) (Apt 8) Protein hlgG-Fc 23 75 nM Binding Buffer (145mM NaCl, 5.4 mM KCl, 0.8mM MgCl, 1.8 mM CaCl, and 20 mM Tris-HCl (pH 7.6)) Modifications at the 5' and 3' end have been made by the authors for various testing. 60.87% 5'-GGAGGUGCUCCGAAAGGAACUCC-3' Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163.
106 Mitomer2 Other Mitochondria 28 20mM Tris-HCl, 2mM KCl, 40mM NaCl, 1mM MgCl2, 250mM Sucrose, pH=7.5 71.43% 5?-UCCCGAUUACUGUACAUACCUUAGCCCAUAGCUGGCUGC-3? Yuri Tawaraya, Mamoru Hyodo, Mst Naznin Ara, Yuma Yamada, and Hideyoshi Harashima, RNA Aptamers for Targeting Mitochondria Using a Mitochondria-Based SELEX Method Biol. Pharm. Bull. 37(8) 1411-1415 (2014)
107 Mitomer1 Other Mitochondria 30 20mM Tris-HCl, 2mM KCl, 40mM NaCl, 1mM MgCl2, 250mM Sucrose, pH=7.5 70.00% 5?-CACCACGAUCACGGUUUCCCUCGCAGGUAAGGUGUAGA-3? Yuri Tawaraya, Mamoru Hyodo, Mst Naznin Ara, Yuma Yamada, and Hideyoshi Harashima, RNA Aptamers for Targeting Mitochondria Using a Mitochondria-Based SELEX Method Biol. Pharm. Bull. 37(8) 1411-1415 (2014)
108 ErbB2 (SE15-8) Protein ErbB2 in Breast Cancer Cells 34 3.49 nM Binding buffer: 20 mM HEPES (pH 7.0), 150 mM NaCl, 1 mM MgCl2, 2 mM DTT, and 40 U RNase Inhibitor 73.53% 5'-AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU-3' Kim and Jeong. "In Vitro Selection of RNA Aptamer and Specific Targeting of ErbB2 in Breast Cancer Cells." Oligonucleotides, doi:10.1089/oli.2011.028
109 Interleukin 8 (8A-35) Protein Interleukin-8 (CXCL-8) 35 1.72 pM 30 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1.5 mM MgCl2, 2mM DTT, and 1% BSA 40.00% 5'-GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC-3' Sung HJ, Choi S, Lee JW, Ok CY, Bae YS, Kim YH, Lee W, Heo K, Kim IH. Inhibition of human neutrophil activity by an RNA aptamer bound to interleukin-8. Biomaterials. 2014 Jan;35(1):578-89. doi: 10.1016/j.biomaterials.2013.09.107. Epub 2013 Oct 13.
110 C5a (C5C6) Protein Human complement C5 component (C5a) 38 100 nM� Binding Buffer: Phosphate-buffered saline with 1 mM MgCl2. 55.26% 5'-CGAUGCGGUCUCAUGCGUCGAGUGUGAGUUUACCUUCG-3' G Biesecker et al.. "Derivation of RNA aptamer inhibitors of human complement C5." Immunopharmacology 42(1999):219-230