To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 411 | Hepatitis C Virus Dependent RNA Polymerase (B.2) | Protein | Hepatitis C Virus Dependent RNA Polymerase | 92 | 1.5 nM | Binding buffer: 20 mM Tris-HCl (pH 7.0), 1 mM dithiothreitol (DTT), 0.25 U/ul RNasin, 100 ng/ul BSA, 250 mM NaCl, 0.03% n-octyl-B-D-glucopyranoside, 5 mM MgCl2, and 2.0% glycerol | 67.39% | 5' GGGAUGCUUCGGCAUCCCCGAAGCCGCUAUGGACCAGUGGCGCGGCUUCGGCCCGACGGAGUGGUACCGCUUCGGCGGUACGUAAGCUUGGG 3' | Biroccio et al. "Selection of RNA Aptamers That Are Specific and High-Affinity Ligands of the Hepatitis C Virus RNA-Dependent RNA Polymerase." J. Virol>, 76 (2002):3688-3696. |
| 412 | 2F11-14 | Protein | Ebola Virus VP35 | 92 | 7.1 nM | 10 mM HEPES (pH 7.0), 150 mM NaCl, 2mM TCEP (tris(2-carboxyethyl)phosphine), and 1 mM MgCl2 and filtered through nitrocellulose membrane | 47.83% | Binning, J., Wang, T., Luthra, P., et al. (2013) Development of RNA aptamers targeting Ebola Virus VP35. Biochemistry, 52(47):8406-8419. doi: 10.1021/bi400704d | |
| 413 | Dopamine (dopa2/c.1) | Small Organic | Dopamine | 93 | 1.6 µM | Column Buffer: 50 mM Tris-HCl (pH 7.4), 5 mM MgCl2, and 0.5 M or 0.15 M NaCl | 58.06% | 5' GGGAAUUCCGCGUGUGCGCCGCGGAAGACGUUGGAAGGAUAGAUACCUACAACGGGGAAUAUAGAGGCCAGCACAUAGUGAGGCCCUCCUCCC 3' | Mannironi, C., et al. "In Vitro Selection of Dopamine RNA Ligands." Biochemistry, 36 (1997): 9726-973. |
| 414 | HA12-16 | Protein | gHA1 protein | 93 | N/A | 20 mM sodium phosphate, pH 7.5, 500 mM NaCl, and 20 mM imidazole | 50.54% | Kwon H-M, Lee KH, Han BW, Han MR, Kim DH, et al. (2014) An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells. PLoS ONE 9(5): e97574. doi:10.1371/journal.pone.0097574 | |
| 415 | Theophylline (AR6) | Small Organic | Theophylline | 94 | N/A nM | Standard Reaction Conditions: 50 mM Tris-HCl, pH 7.5, 20 mM MgCl2 | 52.13% | 5' GGAUAAUAGCCGUAGGUUGCGAAAGCGACCCUGAUGAGUCUGGAUACCAUGCAUGAUGCACCUUGGCAGUCUUACGAAACGGUAGCGAGAGCUC 3' | Seetharaman et al. "Immobilized RNA switches for the analysis of complex chemical and biological mixture." Nature Biotechnology, 19(2001):336-341. |
| 416 | HA 12-16 | Protein | HA protein | 94 | N/A | 20 mM sodium phosphate, pH 7.5, 500 mM NaCl and 20 mM imidazole | 50.00% | Kwon, H. et al. "An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells." PLOS One 2014, 9 1-9. | |
| 417 | HA12-16 | Protein | Avian Influenza Glycoprotein Hemagglutinin (gHA1) | 94 | 20 mM sodium phosphate, pH 7.5, 500 mM NaCl, and 20 mM imidazole | 50.00% | Kwon H-M, Lee KH, Han BW, Han MR, Kim DH, et al. (2014) An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells. PLoS ONE 9(5): e97574. doi:10.1371/journal.pone.0097574 | ||
| 418 | Zinc | Small Organic | Zinc | 95 | 1.2 mM | Buffer A (0.4 M NaCl, 20 mM HEPES-Na (pH 7.0), and 1 mM MgCl2) | 49.47% | 5' GGGAGAGGAUACUACUGUCAUACGUUAGGCUGUAGGCGAGGUGAAAUGAGCGGUAAUAGCCUCAGCGUAGCAUAUGCAUGAAUUCGAAGCUUCGC 3' | Ciesiolka et al., "Selection of an RNA domain that binds Zn2+." Journal of RNA, 1(1995): 538-550. |
| 419 | Hen Egg White Lysozyme (cyt7-2) | Protein | Hen Egg White Lysozyme | 95 | 2.5 µM | Ligation buffer (50 mM Tris, pH 7.5, 100 mM KCl, 10 mM MgCl2) | 49.47% | 5' GGACCUCGGCGAAAGCUAACGUCUCAUGGCUAAAUUGCCAUGUUGCUACAAAUGAUAUGACUAGAGAGGUUAGGUGCCUCGUGAUGUCCAGUCGC 3' | Robertson and Ellington. "In vitro selection of nucleoprotein enzymes." Nature Biotechnology, 19(2001): 650-655. Hesselberth et al. "Simultaneous detection of diverse analytes with an aptazyme ligase array." Analytical Biochemistry, 312(2003): 106-112. |
| 420 | Phosphorylated ERK2 | Protein | Phosphorylated ERK2 | 95 | N/A nM | 34-37 °C, 10 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 0.05 µg/µl tRNA | 48.42% | 5' GGCGUGACCUGAUGAGUCACGCAGACGCUAGCGAAUUGGUUCCUCGAAAGGGGAAAGCGUUAUUAAGAAACCAAAAUGUGUUACGAAACGUUCCC 3' | Vaish et al. "Monitoring post-translational modifications of proteins with allosteric ribozymes." Nature Biotechnology, 20(2002): 810-815. |