To Upload your aptamers in our database
For LOGIN
| # | Aptamer Name | Aptamer Target (General) | Aptamer Target (Specific) | Length | Affinity | Buffer | GC Content | Sequence | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 471 | V7t1 targeting VEGF-165 | Protein | VEGF-165 | 25 | 1.4 nM | 10% (v/v) human serum in TBSTE (TBSE containing 0.05% (v/v) of Tween-20) | 72.00% | 5' TGTGGGGGTGGACGGGCCGGGTAGA 3' | (A) Nonaka,Y., Sode, K., and Ikebukuro, K.(2010) "Screening and Improvement of an Anti-VEGF DNA Aptamer." Molecules, 15, 215-225. (B) Stejskalov?, Anna & Oliva, Nuria & J England, Frances & Almquist, Benjamin. (2019). Biologically Inspired, Cell-Selective Release of Aptamer-Trapped Growth Factors by Traction Forces. Advanced Materials. 1806380. 10.1002/adma.201806380. |
| 472 | Tumor necrosis factor-alpha (TNFa) (VR11) | Protein | Tumor necrosis factor-alpha (TNFa) | 26 | 7.0 nM | Selection Buffer: PBS, 0.005% (v/v) Tween-20 | 64.00% | 5' TGGTGGATGGCGCAGTCGGCGACAA 3' | E Orava et al. A short DNA aptamer that recognizes TNFa and blocks its activity in vitro. ACS Chem. Biol. (2012) Accepted for print. DOI: 10.1021/cb3003557. |
| 473 | Anionic Porphyrins (ST1) | Small Organic | N-methylmesoporphyrin IX (NMM), mesoporphyrin IX (MPIX), and other metalloderivatives | 25 | 0.7 µM | SB Buffer: 100 mM Tris-acetate (pH 7.4), 200 mM sodium acetate, 25 mM potassium acetate, 10 mM magnesium acetate, 0.5% Triton X-100, and 5% dimethyl sulfoxide. | 60.00% | 5' AACGTGGGAGGGCGGTGGTGTTGAA 3' | Y Li, CR Geyer, and D Sen. (1996) Recognition of anionic porphyrins by DNA aptamers. Biochem. 35:6911-6922. |
| 474 | S2.2 | Protein | MUC1 | 25 | 0.135 nM | PBS buffer (pH 7.2); Room Temperature (overnight) | 52.00% | 5' GCAGTTGATCCTTTGGATACCCTGG 3' | D Seleci et al. Aptamer mediated niosomal drug delivery. RSC Adv 6(2016): 87910-87918. |
| 475 | Nucleolin aptamer (AS1411) | Protein | Nucleolin | 26 | N/A nM | For fluoresecent labeling, 400 nM aptamer were added to cell growth media for 1 hour at 37°C and 5% CO2. Dulbecco's phosphate-buffered saline was used to wash cells. | 65.38% | 5' GGTGGTGGTGGTTGTGGTGGTGGTGG 3' | Kotula J, Sullenger B, et al. 2012. Aptamer-mediated delivery of splice-switching oligonucleotides to the nuclei of cancer cells. Nucleic Acid and Therapeutics 22.3:187-195. Li, L. et al. 2014. Aptamer photoregulation in vivo. PNAS 11.48: 17099-103. |
| 476 | VEGF (SL2-B aptamer) | Protein | VEGF (165) | 26 | 0.5 nM | PBS and 0.005% tween-20 solution mixture was used as the running buffer, and 50 mM NaOH as the regeneration buffer. | 61.54% | 5' CAATTGGGCCCGTCCGTATGGTGGGT 3' | Kaur H, Yung L-YL (2012) Probing High Affinity Sequences of DNA Aptamer against VEGF165. PLoS ONE 7(2): e31196. doi:10.1371/journal.pone.0031196 |
| 477 | Anti-VEGF165 | Protein | Recombinant Human Vascular Endothelial Growth Factor | 78 | 0.92 nM | SPR Buffer A: 10 mM phosphate buffered saline; 138 mM NaCl; 2.7 mM KCL; pH 7.4 with 0.005% Tween 20. | 61.54% | A Potty et al. Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor. Biopolymers 91(2008):145-155. | |
| 478 | StrepApt5 | Protein | Streptavidin | 78 | 35 nM | NaCl (100 mM), MgCl2 (2 mM), KCl (5 mM), CaCl2 (1 mM), Tris-HCl (pH 7.6, 20 mM) | 65.38% | Ruigrok, Vincent J. B., et al. "Kinetic and Stoichiometric Characterisation of Streptavidin-Binding Aptamers." ChemBioChem 13 (2012): 829-836. Print. | |
| 479 | Reactive Green 19 (GR-30) | Small Organic | Reactive Green 19 | 27 | 33 µM | Column Buffer: 0.5 M LiCl, 20mM Tris-Cl (pH 7.6), 1 mM MgCl2 | 77.78% | 5' GCAGGGGCGTTCGGGGGGTACCGCTGC 3' | Ellington and Szostak. "Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures." Nature, 355 (1992): 850-852. |
| 480 | L-arginine (12-79) | Small Organic | L-arginine | 28 | ~2.5 mM | Buffer for CD binding assay: 10 mM sodium phosphate buffer (pH 7.5) and 100 mM NaCl. | 62.96% | 5' GACCAGGGCAAACGGTAGGGAGTGGTC 3' | K Harada and A Frankel. (1995) Identification of two novel arginine binding DNAs. EMBO J, 14(23): 5798-5811. |