# Aptamer Name Aptamer Target (General) Aptamer Target (Specific) Length Affinity Buffer GC Content Sequence Reference
481 DNAzymeMB (Part of Lysozyme Aptasensor) Protein N/A 28 0.1 fM NEBuffer 2(10X): 50 mM NaCl, 10 mM Tris-HCL, 10 mM MgCl2�1 mM dithiothreitol, pH 7.9. 57.14% 5' AGGGACGGGCTAAGTAACTGTGGAGGGT 3' Fu et al. "An ultrasensitive peroxidase DNAzyme-associated aptasensor that utilizes a target-triggered enzymatic signal amplification strategy." Chemical Communications, 47(2011): 9876-9878.
482 L-arginine (12-28 hairpin) Small Organic L-arginine 28 ~2.5 nM Buffer for CD binding assay: 10 mM sodium phosphate buffer (pH 7.5) and 100 mM NaCl. 60.71% 5' GGGATCGAAACGTAGCGCCTTCGATCCC 3' K Harada and A Frankel. (1995) Identification of two novel arginine binding DNAs.�EMBO J,�14(23): 5798-5811.
483 Insulin-Linked Polymorphic Region Two-Repeat (ILPR2) Peptide Insulin 28 N/A nM Tris buffer (20 mM Tris, 5mM KCL, pH 7.3) 71.43% 5' ACAGGGGTGTGGGGACAGGGGTGTGGGG 3' Connor A C, McGown L B, et al. (2006) Insulin Capture by an Insulin-Linked Polymorphic Region G-Quadruplex DNA Oligonucleotide.�J Am Chem Soc.�128: 4986-4991
484 Sulforhodamine B (Clone 73 - min) Small Organic Sulforhodamine B 29 190 nM Selection Buffer: 0.1 M KCl, 5 mM MgCl2, 10 mM Na-HEPES (pH 7.4) 82.76% 5' CCGGCCAAGGGTGGGAGGGAGGGGGCCGG 3' Wilson C, Szostak J. (1998) Isolation of a fluorophore-specific DNA aptamer with redox activity.�Chem Biol.�5(11):609-617.
485 Thrombin (29mer) Protein Thrombin 29 0.5 nM� 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM MgCl2 62.07% 5' AGTCCGTGGTAGGGCAGGTTGGGGTGACT 3' Tasset, D. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J. Mol. Biol., 1997(272), 688-698.
486 Kit-129 Protein CD117 29 12.21 nM buffer composed of Dulbecco�s phosphate-buffered saline with calcium and magnesium and 5 mM MgCl2, 0.45% glucose and 100 mg/ml tRNA. 1 hr incubation with cells 65.52% 5' GCTCAACGCGGGACGGCTCTCCCATTGAC 3' Development of an Efficient Targeted Cell-SELEX Procedure for DNA Aptamer Reagents Susanne Meyer et al. 2013
487 StrepApt 2 Protein Streptavidin 29 77 nM NaCl (100 mM), MgCl2 (2 mM), KCl (5 mM), CaCl2 (1 mM), Tris-HCl (pH 7.6, 20 mM) 68.97% Ruigrok, Vincent J. B., et al. "Kinetic and Stoichiometric Characterisation of Streptavidin-Binding Aptamers." ChemBioChem 13 (2012): 829-836. Print.
488 2-PA Protein Anthrax Protective Antigen (PA) 29 1.51 nM 50 uL Human Serum, 5 mM HEPES 58.62% Byul Nim Oh, Sungeun Lee, Hye-Yeon Park, Jin-Ook Baeg, Moon-Young Yoon, and Jinheung Kim. 2011. Reference: Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties. Analyst, 2011, 136, 3384. DOI: 10.1039/c0an00978d
489 Anti-FLAg M2 Antibody Aptamer (ABA) Protein Anti-FLAG M2 Antibody 30 80 nM 4% glycerol, 1 mM MgCL2, 1 mM DTT, 50 mM NaCl, 10 mM Tris-HCl, pH 7.5, r.t. 40.00% 5' TCGATTTCCTTAGTTGTCTTCCTTAGTGAG 3' A Lakamp and M Ouellette. A ssDNA aptamer that blocks the function of the anti-FLAG M2 antibody.�J. Nucleic Acids�2011: doi:10.4061/2011/720798
490 HIV Reverse Transcriptase (PF1) Protein HIV RT 30 80 nM 50 mM Tris-HCl, pH 8, 1mM DTT, 80 mM KCl, 6 mM MgCl2�for ten minutes. 46.67% 5' AGGAAGGCTTTAGGTCTGAGATCTCGGAAT 3' Y-T Lai and J DeStefano. DNA aptamers to human immunodeficiency virus reverse transcriptase selected by a primer-free SELEX method: characterization and comparison with other aptamers.�Nucleic Acid Therapeutics�22(2012): 162-176.